HW3 solution

Lab 6 Answers

1. trees = ["Fraxinus pennsylvanica", "Castanea mollissima", "Quercus rubra"]

2. Quercus rubra

3. For example:

    for tree in trees:
    	print(tree)
   

4. 1 5 9 13 17 21 25 29

5. Line 5, add colon at end and change file to file contents

    file_name = "input_seqs.txt"
    restriction_enzyme = "CTGCAG"
    
    file_contents = open(file_name)
    for seq in file_contents:
    	index = seq.find(restriction_enzyme)
    	print(index)
   

6. answer:

    # open the input file
    file = open("input_seqs.txt")
   
    # open the output file
    output = open("trimmed.txt", "w")  # <--- add write mode
   
    # go through the input file one line at a time
    for dna in file:
        # calculate the position of the last character
        last_character_position = len(dna) # <--- fix var name to dna
        # get the substring from the 15th character to the end
        trimmed_dna = dna[14:last_character_position]
        # print out the trimmed sequence
        output.write(trimmed_dna)
        # print out the length to the screen
        print("processed sequence with length " + str(len(trimmed_dna))) # <--- add str method to print num
   

EC. Example:

	adapter = "ATCTCGTATGCCGTCTTCTGCTTG"

	infile = open("input_seqs.txt")
	outfile = open("indices.txt","w")
	for seq in infile:
		index = seq.find(adapter)
		outfile.write(str(index)+"\n")